Hello all, I had a question about how to properly use the -secstruct_general flag to input non-canonical and canonical basepairing interactions. I’m trying to test this on a simple structure from the 3IRW RNA that has a non-canonical g a basepair but I keep reseiving errors. I am running the following command with the following files.
rna_denovo.static.linuxgccrelease -nstruct 1 -fasta ../test.fasta -secstruct_file ../test.secstruct -secstruct_general ../test.secgen -minimize_rna true -out:file:silent testing.out
test.fasta: gcaaaccauucgaaagagugggacgc
test.secstruct: ((…((((((….))))))…))
test.secgen: ….(…………….)….
Using this setup I get the following error.
ERROR: Length of sequence & secstruct do not match: 26 14
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 270
[ ERROR ]: Caught exception:
File: src/core/pose/rna/RNA_SecStruct.cc:270
[ ERROR ] UtilityExitException
ERROR: Length of sequence & secstruct do not match: 26 14
I entered the secstruct_general file based on my understanding of it from here. https://www.rosettacommons.org/docs/latest/application_documentation/rna/rna-denovo. I have also tried ((..[((((((….))))))]..)) for the -secstruct_general file but it also gives me the error. Any insight or advice would be very helpful, thank you.
.
