connecting rna strands together

Member Site › Forums › Rosetta 3 › Rosetta 3 – Applications › connecting rna strands together

Viewing 1 reply thread
  • Author
    Posts
    • November 9, 2021 at 1:42 pm #3864
      Anonymous

        Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don’t have a structure for ?

        Supposedly: RNA 1 is uaugaaaaua

        RNA2 is cggcgaaagccg

        and their linker is uuu

        making a total of :

        uaugaaaauauuucggcgaaagccg

        How can i do this via rna_denovo?

         

        Thanks in advance for any help!

         

      • November 11, 2021 at 12:51 pm #16060
        Anonymous

          EDIT: resolved this with the tutorials, apparently all i needed to do was just fill in the full sequence into the input fasta while having the relevant fragments located in the input pdb and  the software did the rest for me

           

      • Author
        Posts
      Viewing 1 reply thread
      • You must be logged in to reply to this topic.