Member Site › Forums › Rosetta 3 › Rosetta 3 – Applications › RNA structure prediction
- This topic has 4 replies, 2 voices, and was last updated 11 years, 11 months ago by
Anonymous.
-
AuthorPosts
-
-
February 8, 2014 at 9:30 am #1828
Anonymous
I newly start Rosetta for rna structure prediction. I know that rna_denovo is not suitable for large RNAs. but i tried an approximate 150nt RNA fasta which resulted in structures without any watson crick base pairs! Then I tried the same fasta with a homolog pdb with below command which led to an error after half an hour with one cpu.
./bin/rna_denovo.default.linuxgccrelease -fasta lysine.fasta -native lysine_RNA.pdb -nstruct 2 -out::file::silent lysine2.out -cycles 1000 -minimize_rna -database /opt/rosetta/rosetta_database
Basic usage: ./bin/rna_denovo.default.linuxgccrelease -fasta
[ -native ] Type -help for full slate of options.
core.init: Mini-Rosetta version Split from developer trunk at 53488 from http://www.rosettacommons.org
core.init: command: ./bin/rna_denovo.default.linuxgccrelease -fasta lysine.fasta -native lysine_RNA.pdb -nstruct 2 -out::file::silent lysine2.out -cycles 1000 -minimize_rna -database /opt/rosetta/rosetta_database
core.init: ‘RNG device’ seed mode, using ‘/dev/urandom’, seed=-2099112736 seed_offset=0 real_seed=-2099112736
core.init.random: RandomGenerator:init: Normal mode, seed=-2099112736 RG_type=mt19937
core.chemical.ResidueTypeSet: Finished initializing rna residue type set. Created 2775 residue types
core.io.pdb.file_data: [ WARNING ] discarding 1 atoms at position 1 in file ./lysine_RNA.pdb. Best match rsd_type: RGU_p:LowerRNA
core.io.pdb.file_data: [ WARNING ] can’t find atom for res 1 atom OP3 (trying to set temp)
*************************************************************
Warning … flipping O1P <--> O2P to match mini convention
*************************************************************
Check it! NATIVE ggacggaggcgcgcccgagaugaguaggcugucccaucaggggaggaaucggggacggcugaaaggcgagggcgccgaagcgagcagaguuccucccgcucugcuuggcugggggugaggggaauacccuuaccacugucgcgaaagcggagagccgucca
Check it! EXTEND caacgagauagcccuccaagaaaaugauuucuugacagccuuacauuuguucaaugcacggccagcaaauaaaacagaugggguuuuauuuacuucggcgacgcuccccuuucagccuuuuucacagaaaccaucuuucuccaaaggcuuacucuugaaguucgcaccucuaucuucacc
basic.io.database: Database file opened: chemical/rna/rna_atom_vdw.txt
Reading basepair x-y potential file: chemical/rna/rna_base_pair_xy.dat
Finished reading basepair x-y potential file: chemical/rna/rna_base_pair_xy.dat
Reading non-base-base x-y potential file: chemical/rna/rna_base_backbone_xy.dat
Reading RNA backbone backbone potential file: chemical/rna/rna_backbone_backbone.dat
Reading basepair x-y potential file: chemical/rna/rna_base_pair_xy.dat
Finished reading basepair x-y potential file: chemical/rna/rna_base_pair_xy.dat
Reading non-base-base x-y potential file: chemical/rna/rna_base_backbone_xy.dat
Reading RNA backbone backbone potential file: chemical/rna/rna_backbone_backbone.dat
Setting desired secondary structure to: XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
Reading in vall_torsions file: /opt/rosetta/rosetta_database/chemical/rna/RICHARDSON_RNA09.torsions
Lines read from vall_torsions file: 24459
c[RCY_p:LowerRNA_p:Virtual_Phosphate]aacgagauagcccuccaagaaaaugauuucuugacagccuuacauuuguucaaugcacggccagcaaauaaaacagaugggguuuuauuuacuucggcgacgcuccccuuucagccuuuuucacagaaaccaucuuucuccaaaggcuuacucuugaaguucgcaccucuaucuucacc[RCY_p:UpperRNA]
core.scoring.etable: Starting energy table calculation
core.scoring.etable: smooth_etable: changing atr/rep split to bottom of energy well
core.scoring.etable: smooth_etable: spline smoothing lj etables (maxdis = 6)
core.scoring.etable: smooth_etable: spline smoothing solvation etables (max_dis = 6)
core.scoring.etable: Finished calculating energy tables.
DEFAULT path_to_torsion_files_=/opt/rosetta/rosetta_database/scoring/rna/torsion_potentials/ps_04282011/
basic.io.database: Database file opened: scoring/score_functions/hbonds/standard_params/HBPoly1D.csv
basic.io.database: Database file opened: scoring/score_functions/hbonds/standard_params/HBFadeIntervals.csv
basic.io.database: Database file opened: scoring/score_functions/hbonds/standard_params/HBEval.csv
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/env_log.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/cbeta_den.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/pair_log.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/cenpack_log.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/env_log.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/cbeta_den.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/pair_log.txt
basic.io.database: Database file opened: scoring/score_functions/EnvPairPotential/cenpack_log.txt
basic.io.database: Database file opened: scoring/score_functions/MembranePotential/CEN6_mem_env_log.txt
basic.io.database: Database file opened: scoring/score_functions/MembranePotential/CEN10_mem_env_log.txt
basic.io.database: Database file opened: scoring/score_functions/MembranePotential/memcbeta_den.txt
basic.io.database: Database file opened: scoring/score_functions/MembranePotential/mem_pair_log.txt
basic.io.database: Database file opened: scoring/score_functions/carbon_hbond/ch_o_bond_potential.dat
protocols.rna.rna_structure_parameters: c[RCY_p:LowerRNA_p:Virtual_Phosphate]aacgagauagcccuccaagaaaaugauuucuugacagccuuacauuuguucaaugcacggccagcaaauaaaacagaugggguuuuauuuacuucggcgacgcuccccuuucagccuuuuucacagaaaccaucuuucuccaaaggcuuacucuugaaguucgcaccucuaucuucacc[RCY_p:UpperRNA]
protocols.rna.rna_structure_parameters: FOLD_TREE EDGE 1 180 -1
protocols.rna.rna_structure_parameters:
protocols.rna.rna_denovo_protocol: Heating up…
Picked Fragment Library for sequence g and sec. struct X … found 7881 potential fragments
Picked Fragment Library for sequence u and sec. struct X … found 4630 potential fragments
Picked Fragment Library for sequence c and sec. struct X … found 6239 potential fragments
Picked Fragment Library for sequence a and sec. struct X … found 5709 potential fragments
protocols.rna.rna_denovo_protocol: Beginning main loop…
protocols.rna.rna_denovo_protocol: Beginning round 1 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 3
Picked Fragment Library for sequence cac and sec. struct XXX … found 315 potential fragments
Picked Fragment Library for sequence cuu and sec. struct XXX … found 222 potential fragments
Picked Fragment Library for sequence agg and sec. struct XXX … found 587 potential fragments
Picked Fragment Library for sequence agc and sec. struct XXX … found 523 potential fragments
Picked Fragment Library for sequence uga and sec. struct XXX … found 426 potential fragments
Picked Fragment Library for sequence aag and sec. struct XXX … found 560 potential fragments
Picked Fragment Library for sequence gca and sec. struct XXX … found 392 potential fragments
Picked Fragment Library for sequence uuu and sec. struct XXX … found 249 potential fragments
Picked Fragment Library for sequence cuc and sec. struct XXX … found 297 potential fragments
Picked Fragment Library for sequence acc and sec. struct XXX … found 455 potential fragments
Picked Fragment Library for sequence aaa and sec. struct XXX … found 467 potential fragments
Picked Fragment Library for sequence aau and sec. struct XXX … found 258 potential fragments
Picked Fragment Library for sequence aua and sec. struct XXX … found 187 potential fragments
Picked Fragment Library for sequence cca and sec. struct XXX … found 373 potential fragments
Picked Fragment Library for sequence acg and sec. struct XXX … found 349 potential fragments
Picked Fragment Library for sequence gaa and sec. struct XXX … found 603 potential fragments
Picked Fragment Library for sequence cgg and sec. struct XXX … found 665 potential fragments
Picked Fragment Library for sequence gag and sec. struct XXX … found 548 potential fragments
Picked Fragment Library for sequence ucg and sec. struct XXX … found 342 potential fragments
Picked Fragment Library for sequence gcu and sec. struct XXX … found 400 potential fragments
Picked Fragment Library for sequence caa and sec. struct XXX … found 301 potential fragments
Picked Fragment Library for sequence ucu and sec. struct XXX … found 211 potential fragments
Picked Fragment Library for sequence cag and sec. struct XXX … found 414 potential fragments
Picked Fragment Library for sequence gcc and sec. struct XXX … found 541 potential fragments
Picked Fragment Library for sequence aug and sec. struct XXX … found 339 potential fragments
Picked Fragment Library for sequence uac and sec. struct XXX … found 216 potential fragments
Picked Fragment Library for sequence ccu and sec. struct XXX … found 356 potential fragments
Picked Fragment Library for sequence uau and sec. struct XXX … found 149 potential fragments
Picked Fragment Library for sequence ggg and sec. struct XXX … found 813 potential fragments
Picked Fragment Library for sequence ggc and sec. struct XXX … found 573 potential fragments
Picked Fragment Library for sequence aca and sec. struct XXX … found 243 potential fragments
Picked Fragment Library for sequence ugg and sec. struct XXX … found 488 potential fragments
Picked Fragment Library for sequence guu and sec. struct XXX … found 303 potential fragments
Picked Fragment Library for sequence uua and sec. struct XXX … found 211 potential fragments
Picked Fragment Library for sequence uuc and sec. struct XXX … found 227 potential fragments
Picked Fragment Library for sequence cga and sec. struct XXX … found 467 potential fragments
Picked Fragment Library for sequence cau and sec. struct XXX … found 220 potential fragments
Picked Fragment Library for sequence uca and sec. struct XXX … found 242 potential fragments
Picked Fragment Library for sequence gac and sec. struct XXX … found 361 potential fragments
Picked Fragment Library for sequence aac and sec. struct XXX … found 389 potential fragments
protocols.rna.rna_denovo_protocol: All atom rmsd: 44.2221
protocols.moves.TrialCounter: frag 3 trials= 92; accepts= 0.3261; energy_drop/trial= -8.59446
protocols.rna.rna_denovo_protocol: Beginning round 2 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 3
Picked Fragment Library for sequence aga and sec. struct XXX … found 365 potential fragments
Picked Fragment Library for sequence uaa and sec. struct XXX … found 303 potential fragments
Picked Fragment Library for sequence ccc and sec. struct XXX … found 506 potential fragments
Picked Fragment Library for sequence uug and sec. struct XXX … found 256 potential fragments
Picked Fragment Library for sequence ucc and sec. struct XXX … found 352 potential fragments
Picked Fragment Library for sequence cgc and sec. struct XXX … found 470 potential fragments
Picked Fragment Library for sequence auu and sec. struct XXX … found 169 potential fragments
Picked Fragment Library for sequence gau and sec. struct XXX … found 308 potential fragments
Picked Fragment Library for sequence gcg and sec. struct XXX … found 623 potential fragments
protocols.rna.rna_denovo_protocol: All atom rmsd: 49.1887
protocols.moves.TrialCounter: frag 3 trials= 88; accepts= 0.2386; energy_drop/trial= -1.19962
protocols.rna.rna_denovo_protocol: Beginning round 3 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 3
Picked Fragment Library for sequence cua and sec. struct XXX … found 210 potential fragments
Picked Fragment Library for sequence auc and sec. struct XXX … found 240 potential fragments
Picked Fragment Library for sequence agu and sec. struct XXX … found 344 potential fragments
Picked Fragment Library for sequence ugc and sec. struct XXX … found 390 potential fragments
Picked Fragment Library for sequence ggu and sec. struct XXX … found 604 potential fragments
Picked Fragment Library for sequence ugu and sec. struct XXX … found 271 potential fragments
protocols.rna.rna_denovo_protocol: All atom rmsd: 45.8548
protocols.moves.TrialCounter: frag 3 trials= 91; accepts= 0.2198; energy_drop/trial= -1.80687
protocols.rna.rna_denovo_protocol: Beginning round 4 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 2
Picked Fragment Library for sequence cu and sec. struct XX … found 1201 potential fragments
Picked Fragment Library for sequence au and sec. struct XX … found 935 potential fragments
Picked Fragment Library for sequence ga and sec. struct XX … found 1820 potential fragments
Picked Fragment Library for sequence ag and sec. struct XX … found 1819 potential fragments
Picked Fragment Library for sequence aa and sec. struct XX … found 1674 potential fragments
Picked Fragment Library for sequence uc and sec. struct XX … found 1147 potential fragments
Picked Fragment Library for sequence ac and sec. struct XX … found 1281 potential fragments
Picked Fragment Library for sequence uu and sec. struct XX … found 943 potential fragments
Picked Fragment Library for sequence cc and sec. struct XX … found 1854 potential fragments
Picked Fragment Library for sequence ca and sec. struct XX … found 1250 potential fragments
Picked Fragment Library for sequence cg and sec. struct XX … found 1934 potential fragments
Picked Fragment Library for sequence gc and sec. struct XX … found 1956 potential fragments
Picked Fragment Library for sequence gg and sec. struct XX … found 2553 potential fragments
Picked Fragment Library for sequence ua and sec. struct XX … found 965 potential fragments
Picked Fragment Library for sequence ug and sec. struct XX … found 1575 potential fragments
protocols.rna.rna_denovo_protocol: All atom rmsd: 45.8102
protocols.moves.TrialCounter: frag 2 trials= 95; accepts= 0.2947; energy_drop/trial= -0.87657
protocols.rna.rna_denovo_protocol: Beginning round 5 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 2
Picked Fragment Library for sequence gu and sec. struct XX … found 1551 potential fragments
protocols.rna.rna_denovo_protocol: All atom rmsd: 52.5341
protocols.moves.TrialCounter: frag 2 trials= 86; accepts= 0.2791; energy_drop/trial= -0.09074
protocols.rna.rna_denovo_protocol: Beginning round 6 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 2
protocols.rna.rna_denovo_protocol: All atom rmsd: 39.4399
protocols.moves.TrialCounter: frag 2 trials= 91; accepts= 0.1758; energy_drop/trial= -0.33046
protocols.rna.rna_denovo_protocol: Beginning round 7 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 1
protocols.rna.rna_denovo_protocol: All atom rmsd: 38.7428
protocols.moves.TrialCounter: frag 1 trials= 88; accepts= 0.1250; energy_drop/trial= -0.11251
protocols.rna.rna_denovo_protocol: Beginning round 8 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 1
protocols.rna.rna_denovo_protocol: All atom rmsd: 38.7153
protocols.moves.TrialCounter: frag 1 trials= 90; accepts= 0.1556; energy_drop/trial= -0.07047
protocols.rna.rna_denovo_protocol: Beginning round 9 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 1
protocols.rna.rna_denovo_protocol: All atom rmsd: 37.2709
protocols.moves.TrialCounter: frag 1 trials= 92; accepts= 0.2065; energy_drop/trial= -0.10356
protocols.rna.rna_denovo_protocol: Beginning round 10 of 10
protocols.rna.rna_denovo_protocol: Fragment size: 1
protocols.rna.rna_denovo_protocol: All atom rmsd: 37.2012
protocols.moves.TrialCounter: frag 1 trials= 91; accepts= 0.0659; energy_drop/trial= 0.03392
Scores Weight Raw Score Wghtd.Score
rna_vdw 1.000 55.053 55.053
rna_base_backbone 1.000 -20.452 -20.452
rna_backbone_backbone 1.000 -5.240 -5.240
rna_repulsive 1.000 3.380 3.380
rna_base_pair 1.000 -55.800 -55.800
rna_base_axis 0.200 -25.798 -5.160
rna_base_stagger 1.000 -13.040 -13.040
rna_base_stack 1.000 -1.846 -1.846
rna_base_stack_axis 0.200 -11.441 -2.288
rna_rg 1.000 40.706 40.706
atom_pair_constraint 1.000 0.000 0.000
linear_chainbreak 5.000 0.000 0.000
Total weighted score: -4.688
protocols.rna.rna_denovo_protocol: Finished fragment assembly of S_000001 in 9 seconds.
protocols.rna.rna_minimizer: Orienting 2′ hydroxyls…
protocols.rna.rna_minimizer: Minimizing…round= 1
core.scoring.NeighborList: Minimization stats: 0 score/deriv cals, 0 narrow-from-wide updates, 0 full updates.
core.scoring.NeighborList: Minimization stats: 6635 score/deriv cals, 1933 narrow-from-wide updates, 903 full updates.
protocols.rna.rna_minimizer: Orienting 2′ hydroxyls…
protocols.rna.rna_minimizer: Minimizing…round= 2
core.scoring.NeighborList: Minimization stats: 0 score/deriv cals, 0 narrow-from-wide updates, 0 full updates.
core.scoring.NeighborList: Minimization stats: 7526 score/deriv cals, 1862 narrow-from-wide updates, 301 full updates.
Scores Weight Raw Score Wghtd.Score
fa_atr 0.230 -1779.536 -409.293
fa_rep 0.120 442.402 53.088
fa_intra_rep 0.003 1643.762 4.767
lk_nonpolar 0.320 157.528 50.409
hack_elec_rna_phos_phos 1.050 12.469 13.093
ch_bond 0.420 -791.374 -332.377
rna_torsion 0.100 195.978 19.598
rna_sugar_close 0.700 20.724 14.507
hbond_sr_bb_sc 0.620 -1.835 -1.138
hbond_lr_bb_sc 3.400 -31.211 -106.118
hbond_sc 3.400 -32.416 -110.214
geom_sol 0.620 300.666 186.413
atom_pair_constraint 1.000 0.000 0.000
linear_chainbreak 5.000 0.000 0.000
Total weighted score: -617.266
protocols.rna.rna_minimizer: RNA minimizer finished in 1631 seconds.ERROR: rsd_1.aa()!= rsd_2.aa(). res_num_1= 1 name_from_aa(rsd_1.aa())=RCY res_num_2= 1 name_from_aa(rsd_2.aa())=RGU
ERROR:: Exit from: src/protocols/swa/rna/StepWiseRNA_Util.cc line: 643I would be thankful if any one can help.
-
February 8, 2014 at 9:32 am #9780
Anonymous
I should mention that the version is rosetta 3.5.
-
February 9, 2014 at 6:59 pm #9782
Anonymous
The issue you’re running into is a sequence mismatch issue. It’s trying to work with two structures, one of which is has a ‘C’ for the first nucleotide, and the other has a ‘G’ for the first nucleotide.
Looking at the rest of the logs, I’m presuming that what you’re passing to -native isn’t nucleotide-for-nucleotide identical to the sequence you’re trying to model. (Does it have missing density or zero occupancy regions at the 5′ end?) If it’s not, when Rosetta goes to compute the model-to-native matching at the end of the first model (e.g. a half hour in) it can’t match up the native structure with the model, so it chokes.
rna_denovo is doing de novo modeling rather than homology modeling. You don’t need to pass it a PDB for input – it’ll work with just the fasta file input. The PDB is only being used at the end of the modeling process for benchmarking purposes – how well has the protocol matched up with a known-good structure. This is why it’s assuming a nucleotide-for-nucleotide identical structure.
If you want to incorporate homology information into de novo modeling, the way to do that would be by deriving constraints from the homolog structures, and then doing your rna_denovo run in the presence of those constraints, rather than the structure itself. If you take a look at the rna_denovo documentation (https://www.rosettacommons.org/manuals/archive/rosetta3.5_user_guide/d2/d82/rna_denovo.html) it gives references and talks about modeling larger RNAs with constraints, and there’s even a separate manual page for the process (https://www.rosettacommons.org/manuals/archive/rosetta3.5_user_guide/d7/d6e/rna_assembly.html)
-
February 20, 2014 at 12:53 pm #9830
Anonymous
Thank you very much for the useful help. Is there another way in rosettta to do a homology modeling for RNAs? my sequence is about ~ 150 n and defining constraints is difficult for such a big molecule.
-
February 24, 2014 at 5:12 pm #9832
Anonymous
In the recent weekly releases there is an RNA threading application, which has demos in the demos/public/rna_thread and demos/public/rna_mutate directories. That should work with the first part of the protocol (getting general structures) – you’ll probably need to use some of the other protocols to relax the RNA structure and remodel the loops (e.g. https://www.rosettacommons.org/manuals/archive/rosetta3.5_user_guide/d3/d28/swa_rna_loop.html).
-
-
AuthorPosts
- You must be logged in to reply to this topic.
